![]() |
abiview |
The data for each nucleotide is plotted and the assigned nucleotide (G, A, T, C or N) in the ABI file is overlayed on the graphs.
It also writes out the sequence to an output sequence file.
% abiview -graph cps Reads ABI file and display the trace Input file: ../../data/abiview.abi Output sequence [abiview.fasta]: Created abiview.ps |
Go to the input files for this example
Go to the output files for this example
Mandatory qualifiers: [-fname] infile Name of the ABI trace file [-outseq] seqout Sequence file -graph xygraph Graph type Optional qualifiers: -startbase integer First base to report or display -endbase integer Last sequence base to report or display. If the default is set to zero then the value of this is taken as the maximum number of bases. -yticks boolean Display y-axis ticks -[no]sequence boolean Display the sequence on the graph -window integer Sequence display window size -bases string Base graphs to be displayed Advanced qualifiers: -separate boolean Separate the trace graphs for the 4 bases General qualifiers: -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose |
Mandatory qualifiers | Allowed values | Default | |
---|---|---|---|
[-fname] (Parameter 1) |
Name of the ABI trace file | Input file | Required |
[-outseq] (Parameter 2) |
Sequence file | Writeable sequence | <sequence>.format |
-graph | Graph type | EMBOSS has a list of known devices, including postscript, ps, hpgl, hp7470, hp7580, meta, colourps, cps, xwindows, x11, tektronics, tekt, tek4107t, tek, none, null, text, data, xterm, png | EMBOSS_GRAPHICS value, or x11 |
Optional qualifiers | Allowed values | Default | |
-startbase | First base to report or display | Integer 0 or more | 0 |
-endbase | Last sequence base to report or display. If the default is set to zero then the value of this is taken as the maximum number of bases. | Any integer value | 0 |
-yticks | Display y-axis ticks | Boolean value Yes/No | No |
-[no]sequence | Display the sequence on the graph | Boolean value Yes/No | Yes |
-window | Sequence display window size | Any integer value | 40 |
-bases | Base graphs to be displayed | Any string is accepted | GATC |
Advanced qualifiers | Allowed values | Default | |
-separate | Separate the trace graphs for the 4 bases | Boolean value Yes/No | No |
This file contains non-printing characters and so cannot be displayed here.
This file contains non-printing characters and so cannot be displayed here.
>../../data/abiview.abi GNNNNNNNNNGNGNNGGGGTTTNANNNTNNNAGAACCCCCCTTNGAAAANNNCCACCCCA NNATAGTNGTANGAATAGTNCCCAGGCCANGCCTATCTGTGATGATTACATAGGCTAACA CATGACAAACATTTAAAAACACTAAACAATTGTTATTTATTCTTTGTTCCTATAAACCAC ACCCATTAAGCCCTTACTATATATAAGAGTTTTCAAGCCAAGAACCTGCTGCTTGGGAGG CTGATGCAGGAGAATTGCCAAGTACAAACCCTGCCTGGACTGTAAAGTGAAACCAAGGCT AGTTGTCTCACAATAAAAGATGAAGGGCAAGTGGGATCAATGCATAAAGGAGCTTGTGCC CAAGCCTGTTAGCCTTAGTTCAATTCCTGAGTACCATGAAAAGGTAGAAGGAGAGAAATG ATTTGGTACAATTTTTCTCTGTGCTGTGACACAGTACCACCCTCCTACTAATAACAAATA AAATAATGTTTAAAACAAAATAAAATAAAAATGGACTGGGATGTAGCACAATGGTAGGGT ACTTGCATAGCATGTACAAGGACCTGATTTCAATCCCCTGTGATAAAAGAAAATAAGGAA GGGAGGAAGCGTTAGGAGGAAAAATGGAATACAGAAGACACAGTGCATGGGAAGGATATG TATGTTATGAACACCAGAAATTCACTTGAAAATGAGTAAAATTTTTTTATTATTATATCA TTATTATTGGGGGGGATGTGGGCGGGGCTTGCAGAGGTATCTTTTAGAGGANGATCATTT TCCGGTTGTTGAGCAGGGCTCTGTTATGTAGGATATCTCAGANTAACAGACCCCAGGT |
The horizontal scale of the output image labelled 'Residue Position' is only a very approximate indication of the spacing of residues in the image. The real residue spacing is variable, as it relies on the speed with which the oligo-nucleotides are eluted in the ABI sequencer. Do not be surprised to see the nucleotide signals spaced at a much greater distance than the horizontal scale might suggest.
Program name | Description |
---|---|
cirdna | Draws circular maps of DNA constructs |
lindna | Draws linear maps of DNA constructs |
pepnet | Displays proteins as a helical net |
pepwheel | Shows protein sequences as helices |
prettyplot | Displays aligned sequences, with colouring and boxing |
prettyseq | Output sequence with translated ranges |
remap | Display a sequence with restriction cut sites, translation etc |
seealso | Finds programs sharing group names |
showalign | Displays a multiple sequence alignment |
showdb | Displays information on the currently available databases |
showfeat | Show features of a sequence |
showseq | Display a sequence with features, translation etc |
sixpack | Display a DNA sequence with 6-frame translation and ORFs |
textsearch | Search sequence documentation text. SRS and Entrez are faster! |